Products/Services Used | Details | Operation |
---|---|---|
Codon Optimization | … pHR331 - HCV 2A NS3 C-terminal 3X flag pHR350 - HCV 2A NS5B (codon optimized by GenScript) N-terminal 3X flag … CTCCCTCGAGCGGCCGCACGGTCATGACC TCAAGGTCAG HCV 2A NS5B (codon optimized by GenScript) N- terminal 3X flag … | Get A Quote |
Hepatitis C virus (HCV) is a leading cause of liver disease, but insight into virus-host interactions remains limited. We systematically used affinity purification/mass spectrometry to define the host interactions of all ten HCV proteins in hepatoma cells. We combined these studies with RNAi knockdown of corresponding genes using a two-step scoring approach to generate a map of 139 high-confidence HCV-host protein-protein interactions. We found mitochondrial proteins highly involved in HCV infection and characterized an interaction between the viral core protein and host protein within bgcn homolog (WIBG). Expression of core prevents WIBG from binding its regular interaction partners Y14 and Magoh, two kn... More