Products/Services Used | Details | Operation |
---|---|---|
Codon Optimization | Preparation of recombinant proteins and their analogues The gene sequence of recombinant protein Fv-LDP-D3 was synthesized by GenScript based on Pichia pastoris preferring codon usage, and primers as followed were designed to amplify the gene sequences of Fv-LDP and LDP-D3: P1, TCTGTACGTAATGGCCCAGGTCCAGCTTC, ATAAGAATGCGGCCGCTTAGTGATGGTGATGG, TCTGTACGTAGCTCCAGCTTTCTCTG, P2, P3, P4, ATAAGAATGCGGCCGCTTAGTGGTGGTGGTGGTGGTGTCCGAAAGTCAAA GC. | Get A Quote |
Enhanced macropinocytosis has been found in K-Ras mutant pancreatic cancer cells, through which albumin can massively enter into the K-Ras-driven cancer cells, suggesting its role in serving as a macropinocytosis-intensifying drug delivery carrier. In the present study, a novel recombinant protein Fv-LDP-D3 and its reconstituted analogue Fv-LDP-D3-AE were designed and prepared. Fv is the fragment of an anti-EGFR antibody, D3 is the domain III of human serum albumin (HSA), LDP is the apoprotein of the antitumor antibiotic lidamycin (LDM), and AE is an extremely cytotoxic enediyne chromophore derived from LDM. As shown, the recombinant protein Fv-LDP-D3 presented intensive and selective binding capacity to pancre... More