Products/Services Used | Details | Operation |
---|---|---|
Gene Synthesis | 20nt ssRNA sequence: UUUCACCUCCCUUUCAGUUU(genscript) | Get A Quote |
Nucleocapsid proteins are essential for SARS-CoV-2 life cycle. Here, we describe protocols to gather domain-specific insights about essential properties of nucleocapsids. These assays include dynamic light scattering to characterize oligomerization, fluorescence polarization to quantify RNA binding, hydrogen-deuterium exchange mass spectrometry to map RNA binding regions, negative-stain electron microscopy to visualize oligomeric species, interferon reporter assay to evaluate interferon signaling modulation, and a serology assay to reveal insights for improved sensitivity and specificity. These assays are broadly applicable to RNA-encapsidated nucleocapsids. For complete details on the use and execution of this... More