Products/Services Used | Details | Operation |
---|---|---|
Gene Services | The backbone plasmids lenti-sgRNA and lenti-cas9-zeocin were obtained from GenScript Co., Ltd. (Nanjing, China). sgRNA (AATTCCCACAAGGACAAAAG) was designed and subcloned into the cas9 backbone. Lucia luciferase reporter HEK293cells were first infected with lenti-cas9-zeocin and then selected using zeocin. The stable sublines were then infected with lenti-sgRNA to specifically knock out the target genes. | Get A Quote |
With the continuous in-depth study of the interaction mechanism between viruses and hosts, the virus has become a promising tool in cancer treatment. In fact, many oncolytic viruses with selectivity and effectiveness have been used in cancer therapy. Human enterovirus is one of the most convenient sources to generate oncolytic viruses, however, the high seroprevalence of some enteroviruses limits its application which urges to exploit more oncolytic enteroviruses. In this study, coxsackievirus B5/Faulkner (CV-B5/F) was screened for its potential oncolytic effect against non-small cell lung cancers (NSCLCs) through inducing apoptosis and autophagy. For refractory NSCLCs, DNA-dependent protein kinase (DNA-PK) or ... More