Products/Services Used | Details | Operation |
---|---|---|
Molecular Biology Reagents | … -Cas9 system, the sgRNA sequence targeting LSD1 (GTCGGACCAGCCGGCGCAAG (sgRNA #1) and CGCGGAGGCTCTTTCTTGCG (sgRNA #2)) were synthesized by GenScript. The … | Get A Quote |
Poly (ADP-ribose) polymerase inhibitors (PARPi) are selectively active in ovarian cancer (OC) with homologous recombination (HR) deficiency (HRD) caused by mutations in BRCA1/2 and other DNA repair pathway members. We sought molecular targeted therapy that induce HRD in HR-proficient cells to induce synthetic lethality with PARPi and extend the utility of PARPi. Here, we demonstrate that lysine-specific demethylase 1 (LSD1) is an important regulator for OC. Importantly, genetic depletion or pharmacological inhibition of LSD1 induces HRD and sensitizes HR-proficient OC cells to PARPi in vitro and in multiple in vivo models. Mechanistically, LSD1 inhibition directly impairs transcription of BRCA1/2 and RAD51, thr... More