Products/Services Used | Details | Operation |
---|---|---|
Gene Synthesis | … Egr-1 mRNA expression in the … plasmid containing the mouse Opn5 gRNA sequence (GCTCAGGTGCATAGTCCCCC) and a puromycin resistance gene was synthesized by GenScript (… | Get A Quote |
Myopia is an abnormal vision condition characterized by difficulties in seeing distant objects. Myopia has become a public health issue not only in Asian countries but also in Western countries. Previously, we found that violet light (VL, 360-400 nm wavelength) exposure effectively suppressed myopia progression in experimental chick and mice models of myopia. The inhibitory effects of VL on myopia progression are reduced in retina-specific opsin 5 (Opn5) knockout (KO) mice. Furthermore, VL exposure upregulated early growth response-1 (Egr-1) expression in the chorioretinal tissues of chicks. However, the expression of EGR-1 and role of OPN5 in mice following VL exposure remain unclear. In this study, we examin... More